View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2206_high_5 (Length: 445)
Name: NF2206_high_5
Description: NF2206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2206_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 398; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 1 - 430
Target Start/End: Complemental strand, 9488911 - 9488482
Alignment:
| Q |
1 |
tggtcattgagttggtttacccaagcttttgtctccttagatttctctgctgcacattttctctggcgccatggcagtagcggtggatattgggacatgc |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9488911 |
tggtcattgggttggtttacccaagcttttgtctccttagatttctctgctacacattttctctggcgccatggcagtagcggtggatattcggacatgc |
9488812 |
T |
|
| Q |
101 |
acgtgacccaaatctgcacggtggtcagaatcttttctgcacttggcttggcctatacgactcaaaccaggtttgtgctttcttttgtttctgctatcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9488811 |
acgtgacccaaatctgcacggtggtcagaatcttttctgcacttggcttggcctatacgactcaaaccaggtttgtgctttcttttgtttctgctatcat |
9488712 |
T |
|
| Q |
201 |
ctaagtaacgtcaggtttcaccatctatgttaattgcttcattgtcaccgatctttctttcccttccgtatccaaacttgagcatgacaattttgatgac |
300 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9488711 |
ctaagtaacgtcaggtttcaccatcgatgttaattgcttcattgtcaccgatctttctttcccttccgtatccaaacttgagcatgacaattttgatgac |
9488612 |
T |
|
| Q |
301 |
aatggtggattgtccggtgctcgtgattatctgtttatattttggcctgcagcattttaatgtctcttttttctcttcgtctttccctttctgttcgcgc |
400 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9488611 |
gatagtgggttgtccggtgctcgtgattatctgtttatattttggcctgcagcattttaatgtctcttttttctcttcgtctttccctttctgttcgcgc |
9488512 |
T |
|
| Q |
401 |
atttgcaggattcatccacaactgttcgat |
430 |
Q |
| |
|
||||||||||||| |||||||||||||||| |
|
|
| T |
9488511 |
atttgcaggattcttccacaactgttcgat |
9488482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University