View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2206_low_12 (Length: 282)
Name: NF2206_low_12
Description: NF2206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2206_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 234 - 268
Target Start/End: Complemental strand, 15584521 - 15584487
Alignment:
| Q |
234 |
ggatactgcaccgaaatctcttcaaatggttcttt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15584521 |
ggatactgcaccgaaatctcttcaaatggttcttt |
15584487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 110
Target Start/End: Complemental strand, 15550011 - 15549981
Alignment:
| Q |
80 |
tttgtgaaattatcaaatgcatgtgcttaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15550011 |
tttgtgaaattatcaaatgcatgtgcttaaa |
15549981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University