View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2206_low_21 (Length: 212)
Name: NF2206_low_21
Description: NF2206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2206_low_21 |
 | |
|
| [»] scaffold0115 (1 HSPs) |
| | |
|
| [»] scaffold0050 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0115 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: scaffold0115
Description:
Target: scaffold0115; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 12 - 193
Target Start/End: Original strand, 31875 - 32056
Alignment:
| Q |
12 |
aagaatataattttaataaataaagagtaataattaagtataatatgcatgtattattgccttcttatattcaagatatcacaactttactacttattgt |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31875 |
aagaaaataattttaataaataaagagtaataattaagtataatatgcatgtattattgccttcttatattcaagatatcacaactttactacttattgt |
31974 |
T |
|
| Q |
112 |
gcttccaaattattagcttagtgcttcgatcttatcgttaagaattttgttgcttgtttcccacgcataagtagtagcttgt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31975 |
gcttccaaattattagcttagtgcttcgatcttatcgttaaaaaatttgttgcttgttccccacgcataagtagtagcttgt |
32056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 94 - 167
Target Start/End: Original strand, 20257 - 20329
Alignment:
| Q |
94 |
aactttactacttattgtgcttccaaattattagcttagtgcttcgatcttatcgttaagaattttgttgcttg |
167 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||| |||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
20257 |
aactttactacttcttgcgcttccaaattattagct-agtgcttcgatcttatcgctaagaatttagttgcttg |
20329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University