View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2206_low_8 (Length: 367)
Name: NF2206_low_8
Description: NF2206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2206_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 19 - 259
Target Start/End: Complemental strand, 31643429 - 31643186
Alignment:
| Q |
19 |
gaagattccgtaactatt---gacttccattcaccttcatcgcagttggctagtaccgacattggtagtagtatgggcgaacaactcggtccttatgaga |
115 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31643429 |
gaagattccgtaactattattgacttccattcaccttcatcacagttggctagtaccgacattggtagtagtatgggcgaacaactcggtcattatgaga |
31643330 |
T |
|
| Q |
116 |
aggcgcttcaacaagaaaattcacatccggttgaaattaaggaagaaccagataataaagaagagaataatgagttcgatttctggatggtacaatcctc |
215 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
31643329 |
aggcgcttcaacaagaaaattcacatctggttgaaattaaggaagaaccagataataaagaagagaataatgagttcgattcccggatggtacaatcctt |
31643230 |
T |
|
| Q |
216 |
tgacatgcttaacttatattctaaccgaaccggagggctaacac |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31643229 |
tgacatgcttaacttatattctaaccgaaccggagggctaacac |
31643186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 307 - 355
Target Start/End: Complemental strand, 31643135 - 31643087
Alignment:
| Q |
307 |
catgcctctgtccctcttttagagatggtgaaagcttaccagacatatt |
355 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31643135 |
catgcctctgcccctcttttagagatggtgaaagcttaccagacatatt |
31643087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University