View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2207_low_6 (Length: 239)
Name: NF2207_low_6
Description: NF2207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2207_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 24 - 228
Target Start/End: Complemental strand, 21579854 - 21579653
Alignment:
| Q |
24 |
agctaccttaatcaatttcattgccgtcatcttatagtttaaaaccttaacttcaaaatacatgaaattaaggggaaaacaaagatnnnnnnnnnnnnnn |
123 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21579854 |
agctaccttaatcaatttcattgccatcatcttatagtataaaatcataacttcaaaatacatgaaattaaggggaaaacaaagataaaaaaaaaa---- |
21579759 |
T |
 |
| Q |
124 |
nnttcaatt-atttggtggatgtagaaaaattaaatcata--gctcatgaaatattctagcatatatcgtacaattattttttctggtgcaaggactcgt |
220 |
Q |
| |
|
| ||||| |||||||| ||||||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21579758 |
--tacaatttatttggtgcatgtagacaaactaaatcatacagctcatgaaatattctagcatatatcgtacaattattttttctggtgcaaggactcat |
21579661 |
T |
 |
| Q |
221 |
tcatctca |
228 |
Q |
| |
|
|||||||| |
|
|
| T |
21579660 |
tcatctca |
21579653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University