View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2207_low_9 (Length: 218)
Name: NF2207_low_9
Description: NF2207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2207_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 7185010 - 7185117
Alignment:
| Q |
1 |
ttgcaacaacagctagcttcatctgctcaactgcaacaaaactcttcgaccctgaaccaattgccccagttgatgcagcagcagaaatccatggggcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7185010 |
ttgcaacaacagctagcttcatctgctcaactgcaacaaaactcttcgaccctgaaccaattgccccagttgatgcagcagcagaaatccatggggcaac |
7185109 |
T |
|
| Q |
101 |
ctctgctt |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
7185110 |
ctctgctt |
7185117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 2 - 108
Target Start/End: Original strand, 7184837 - 7184949
Alignment:
| Q |
2 |
tgcaacaacagctagcttcatctgctcaactgcaacaaaactcttcgaccctgaac------caattgccccagttgatgcagcagcagaaatccatggg |
95 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||| ||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
7184837 |
tgcaacaacagctggcttcatctgctcaactgcaacaaaactctttgaccctcaaccaacagcaattgcccttgttgatgcagcagccgaaatccatggg |
7184936 |
T |
|
| Q |
96 |
gcaacctctgctt |
108 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7184937 |
gcaacctctgctt |
7184949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 3 - 108
Target Start/End: Original strand, 7190022 - 7190133
Alignment:
| Q |
3 |
gcaacaacagctagcttcatctgctcaactgcaacaaaactcttcgaccctgaaccaa------ttgccccagttgatgcagcagcagaaatccatgggg |
96 |
Q |
| |
|
|||||| ||||| |||||||||| ||||||||||||||||||| ||||||||||||| ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
7190022 |
gcaacagcagctggcttcatctggtcaactgcaacaaaactctatgaccctgaaccaacagcaattgtcccagtttatgcagcagcagaaatccatgggg |
7190121 |
T |
|
| Q |
97 |
caacctctgctt |
108 |
Q |
| |
|
||||||| |||| |
|
|
| T |
7190122 |
caacctcagctt |
7190133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 2 - 60
Target Start/End: Original strand, 7156055 - 7156113
Alignment:
| Q |
2 |
tgcaacaacagctagcttcatctgctcaactgcaacaaaactcttcgaccctgaaccaa |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
7156055 |
tgcaacaacagctagcttcatctgctcaactgcaacaaaactccttgaccctgaaccaa |
7156113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 7 - 101
Target Start/End: Original strand, 7184662 - 7184762
Alignment:
| Q |
7 |
caacagctagcttcatctgctcaactgcaacaaaactcttcgaccctgaac------caattgccccagttgatgcagcagcagaaatccatggggcaac |
100 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||| ||||| |||||||||| |||||||| |||||||||||||||| |||| |||||||||||| |
|
|
| T |
7184662 |
caacagctggcttcatctgctcaacttcaacaaagctctttgaccctgaaccaacagcaattgcctcagttgatgcagcagccgaaacccatggggcaac |
7184761 |
T |
|
| Q |
101 |
c |
101 |
Q |
| |
|
| |
|
|
| T |
7184762 |
c |
7184762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 7 - 60
Target Start/End: Original strand, 7155856 - 7155909
Alignment:
| Q |
7 |
caacagctagcttcatctgctcaactgcaacaaaactcttcgaccctgaaccaa |
60 |
Q |
| |
|
||||| || ||||||||||||||| | ||||||||||||| |||||| |||||| |
|
|
| T |
7155856 |
caacaactggcttcatctgctcaatttcaacaaaactctttgacccttaaccaa |
7155909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University