View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2209-Insertion-6 (Length: 209)
Name: NF2209-Insertion-6
Description: NF2209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2209-Insertion-6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 8 - 209
Target Start/End: Original strand, 50244924 - 50245120
Alignment:
| Q |
8 |
cattttgataattgtttggaattaaccatgatgacatgagcatgaagaacttgatgtcataattttatttggtgcatattcaacttcttttttgttatag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
50244924 |
cattttgataattgtttggaattaaccatgatga-----gcatgaagaacttgatgtcataattttatttggtgcatattcaactttttttttggtatag |
50245018 |
T |
 |
| Q |
108 |
aattacataatggcacaggtcaacaagatatttccttgaatgcattttcaagccttggtgcagaccttataattgtggaatgtagaccaacaattacgaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50245019 |
aattacataatggcacaggtcaacaagatatttccttgaatgcattttcaagccttggtgcagaccttataattgtggaatgtagaccaacaattacgaa |
50245118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University