View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2209R-Insertion-8 (Length: 400)
Name: NF2209R-Insertion-8
Description: NF2209R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2209R-Insertion-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 75 - 359
Target Start/End: Original strand, 50788151 - 50788434
Alignment:
| Q |
75 |
gacaaagattaagacgagctggatatgacaaaacaaattgtgataagagaaagcatgagaaagtgatgtatcatagattcaaatctttgaagacaaatta |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50788151 |
gacaaagattaagacgagctggatatgacaaa-caaattgtgataagagaaagcatgagaaagtgatgtatcatagattcaaatctttgaagacaaatta |
50788249 |
T |
|
| Q |
175 |
aaatatgatccaagtttagaagaaattaagacatgccagtccagattcaatgtcacttatctatcaagtacagtccacgttgtcatttggaatttctcca |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50788250 |
aaatatgatccaagtttagaagaaattaagacatgccagtccagattcaatgtcacttatctatcaagtacagtccacgttgtcatttggaatttctcca |
50788349 |
T |
|
| Q |
275 |
attctctacttatggatttcttcaaattaagtgccttaattactttcttataatgctactaatttattctactcattgatcatcc |
359 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50788350 |
attctctacttatggatttcttcaaattcagtgccttaattactttcttataatgctactaatctattctactcattgatcatcc |
50788434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 368 - 400
Target Start/End: Original strand, 50788450 - 50788482
Alignment:
| Q |
368 |
cttttgtcccattatacataccatgattgccta |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
50788450 |
cttttgtcccattatacataccatgattgccta |
50788482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University