View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2209_high_17 (Length: 251)
Name: NF2209_high_17
Description: NF2209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2209_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 22 - 240
Target Start/End: Complemental strand, 48486805 - 48486587
Alignment:
| Q |
22 |
gggcagacccgattgtacaagaccaaaggaagtgactttcacgaggcaatggaggaggcaatgttggcagataatggcattctggatccacattatagag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486805 |
gggcagacccgattgtacaagaccaaaggaagtgactttcacgaggcaatggaggaggcaatgttggcagataatggcattctggatccacattatagag |
48486706 |
T |
|
| Q |
122 |
ctaagcaaattgtggagggtgcgacttcctgtgctgaacaggaatatcactgccaaggccaggtgattttaatttttccacttcgtgttgtgtatgatca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486705 |
ctaagcaaattgtggagggtgcgacttcctgtgctgaacaggaatatcactgccaaggccaggtgattttaatttttccacttcgtgttgtgtatgatca |
48486606 |
T |
|
| Q |
222 |
tgattcatgactgatgatg |
240 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
48486605 |
tgattcatgactgatgatg |
48486587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University