View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2209_high_8 (Length: 418)
Name: NF2209_high_8
Description: NF2209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2209_high_8 |
 |  |
|
| [»] scaffold0074 (1 HSPs) |
 |  |  |
|
| [»] scaffold0131 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 1e-51; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 6 - 160
Target Start/End: Original strand, 33897472 - 33897627
Alignment:
| Q |
6 |
cgagtcaccggtttaatccggttctggccgagtttgaccagttcatagtggttcaataacataaccgatccaattagtggaccgaaccggctaaccatct |
105 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||| | |||||||| ||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
33897472 |
cgagtcgccggtttaatccggttctggccgagtttgaccggttcacaacggttcaatgacatatccgatccaataagtggaccggaccggctaaccatct |
33897571 |
T |
 |
| Q |
106 |
ggttcacagtcggaccggttcgaccgg-ccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
33897572 |
ggttcacggtcggaccggttcgaccggtccggtccggtctgagttttaaaactatg |
33897627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 16 - 160
Target Start/End: Complemental strand, 32623155 - 32623011
Alignment:
| Q |
16 |
gtttaatccggttctggccgagtttgaccagttcatagtggttcaataacataaccgatccaattagtggaccgaaccggctaaccatctggttcacagt |
115 |
Q |
| |
|
||||| ||||||| ||| |||||| ||| |||||||| || |||||||||| ||||||||||| ||| |||||||||| || | | | ||||| || |
|
|
| T |
32623155 |
gtttattccggttttggtcgagttacaccggttcatagcggatcaataacatgaccgatccaataagttgaccgaaccgacttatccaccggttcctggt |
32623056 |
T |
 |
| Q |
116 |
cggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32623055 |
cggaccggttcgaccggccggtccgatccgagttttaaaactatg |
32623011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 69 - 160
Target Start/End: Complemental strand, 8760299 - 8760208
Alignment:
| Q |
69 |
accgatccaattagtggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||| || |||||||||| || || || ||||||| |||||||||||||||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
8760299 |
accgatccaatatgtcaaccgaaccggttacccctccggttcacggtcggaccggttcgaccggccgatccggtccggttttcaaaactatg |
8760208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 58 - 156
Target Start/End: Complemental strand, 814038 - 813945
Alignment:
| Q |
58 |
tcaataacataaccgatccaattagtggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaac |
156 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||| |||| | | ||||||||| || | ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
814038 |
tcaatagcataaccgatccaataagtgaaccggaccgccca-----ctggttcacggttgaaccggttcgaccggccggtccagtccgagttttaaaac |
813945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 99 - 161
Target Start/End: Original strand, 6460561 - 6460623
Alignment:
| Q |
99 |
accatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| || || |||| |||||||||| |
|
|
| T |
6460561 |
accatccggttcacagtcggactggttcgaccggccggtcctgttcgtgtttcaaaactatgg |
6460623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 160
Target Start/End: Original strand, 22638803 - 22638849
Alignment:
| Q |
114 |
gtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| ||| ||||||||| |
|
|
| T |
22638803 |
gtcggaccggttcaaccggccggtccgatccgattttcaaaactatg |
22638849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 108 - 142
Target Start/End: Complemental strand, 36745580 - 36745546
Alignment:
| Q |
108 |
ttcacagtcggaccggttcgaccggccggtccggt |
142 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36745580 |
ttcacggtcggaccggttcgaccggccggtccggt |
36745546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0074 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: scaffold0074
Description:
Target: scaffold0074; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 6 - 160
Target Start/End: Complemental strand, 55074 - 54920
Alignment:
| Q |
6 |
cgagtcaccggtttaatccggttctggccgagtttgaccagttcatagtggttcaataacataaccgatccaattagtggaccgaaccggctaaccatct |
105 |
Q |
| |
|
|||||| | ||||||| || |||||||||||||||||| ||||| | |||||||| ||||| |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
55074 |
cgagtcgctggtttaagccagttctggccgagtttgactggttcacaacggttcaatgacatatccgatccaataagtggaccggaccggctaaccatcc |
54975 |
T |
 |
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
54974 |
ggttcacggtcggaccagttcgaccggccggtccagttcgagttttaaaactatg |
54920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 71; Significance: 5e-32; HSPs: 14)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 7 - 161
Target Start/End: Original strand, 35564085 - 35564230
Alignment:
| Q |
7 |
gagtcaccggtttaatccggttctggccgagtttgaccagttcatagtggttcaataacataaccgatccaattagtggaccgaaccggctaaccatctg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||| || ||||||||| |||||||||||||||||||||||||||||| |||| | |||| |
|
|
| T |
35564085 |
gagtcaccggtttaatccggttctggccgagtttgatcggttcgcagcggttcaatagcataaccgatccaattagtggaccgaaccgactaaacctctg |
35564184 |
T |
 |
| Q |
107 |
gttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
||||| |||||||| ||||| ||||| | |||||||||||||||||| |
|
|
| T |
35564185 |
gttca---------cggttcgatcggccagtccgatacgagttttaaaactatgg |
35564230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 23 - 160
Target Start/End: Complemental strand, 45103484 - 45103347
Alignment:
| Q |
23 |
ccggttctggccgagtttgaccagttcatagtggttcaataacataaccgatccaattagtggaccgaaccggctaaccatctggttcacagtcggaccg |
122 |
Q |
| |
|
||||||| ||||||||| ||| |||| ||| | |||||| ||||||||||||||| |||| |||| ||||||| | | | ||||||| |||| |||| |
|
|
| T |
45103484 |
ccggttcaggccgagttacaccggttcgtagcgagtcaatagcataaccgatccaataagtgaaccggaccggcttatccaccggttcacggtcgaaccg |
45103385 |
T |
 |
| Q |
123 |
gttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
45103384 |
gttcgatcggccggtccggtccgagttttaaaattatg |
45103347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 86 - 160
Target Start/End: Complemental strand, 2848568 - 2848494
Alignment:
| Q |
86 |
accgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||||||| || || || ||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2848568 |
accgaaccggttacccctccggttcacggtcggaccggttcgaccggccggtccggtccggtttttaaaactatg |
2848494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 51536428 - 51536374
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
51536428 |
ggttcacggtcggaccggttcgaccggccggtccgatccggtttttaaaactatg |
51536374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 53612638 - 53612692
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||| ||||| |||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
53612638 |
ggttcgcagtccgaccggttcgaccggccgatccggtccgaattttaaaactatg |
53612692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 69 - 160
Target Start/End: Original strand, 33635785 - 33635876
Alignment:
| Q |
69 |
accgatccaattagtggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||| || |||||||||| || || || | ||||| |||||||||||||||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
33635785 |
accgatccaatatgtcaaccgaaccggttacccctccgattcacggtcggaccggttcgaccggccgatccggtccggttttcaaaactatg |
33635876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 104 - 161
Target Start/End: Original strand, 29728803 - 29728860
Alignment:
| Q |
104 |
ctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
29728803 |
ctggttcacggtcggaccggttcgaccggccggtccgagccagtttttaaaactatgg |
29728860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 114 - 163
Target Start/End: Complemental strand, 30464543 - 30464494
Alignment:
| Q |
114 |
gtcggaccggttcgaccggccggtccggtccgagttttaaaactatggat |
163 |
Q |
| |
|
||||||||||||| |||||||||||||||| || ||| |||||||||||| |
|
|
| T |
30464543 |
gtcggaccggttcaaccggccggtccggtctgattttcaaaactatggat |
30464494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 69 - 161
Target Start/End: Complemental strand, 10258405 - 10258313
Alignment:
| Q |
69 |
accgatccaattagtggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
||||||||||| || |||||||||| || || || ||||||| ||| ||| ||||||| |||||||||||||||| ||| |||||||||| |
|
|
| T |
10258405 |
accgatccaatatgtcaaccgaaccggttacccctccggttcacggtccgactggttcgatcggccggtccggtccggttttcaaaactatgg |
10258313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 160
Target Start/End: Complemental strand, 23241365 - 23241319
Alignment:
| Q |
114 |
gtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||| ||||||||| |
|
|
| T |
23241365 |
gtcggaccggttcaaccggccggtccggtccggttttcaaaactatg |
23241319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 106 - 140
Target Start/End: Original strand, 42908684 - 42908718
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccg |
140 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42908684 |
ggttcacggtcggaccggttcgaccggccggtccg |
42908718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 104 - 161
Target Start/End: Complemental strand, 11334832 - 11334776
Alignment:
| Q |
104 |
ctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| ||| |||||||||| |
|
|
| T |
11334832 |
ctggttcacagtcggaccggtt-aactggccggtccggtccggttttcaaaactatgg |
11334776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 325 - 357
Target Start/End: Complemental strand, 16680051 - 16680019
Alignment:
| Q |
325 |
gcttttctagtttggttcaccagatatatagtt |
357 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
16680051 |
gcttttctagtttggttcaccagatttatagtt |
16680019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 106 - 142
Target Start/End: Original strand, 39851435 - 39851471
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccggt |
142 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
39851435 |
ggttcacggtcggaccggttcaaccggccggtccggt |
39851471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 7e-25; HSPs: 14)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 6 - 112
Target Start/End: Complemental strand, 24096117 - 24096011
Alignment:
| Q |
6 |
cgagtcaccggtttaatccggttctggccgagtttgaccagttcatagtggttcaataacataaccgatccaattagtggaccgaaccggctaaccatct |
105 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||| | |||||||| ||||| | |||||||| |||||| || |||||||||||||| |
|
|
| T |
24096117 |
cgagtcaccggtttaatccggttctggtcgagtttgaccggttcacaacggttcaatgacatatctgatccaataagtggatcggaccggctaaccatcc |
24096018 |
T |
 |
| Q |
106 |
ggttcac |
112 |
Q |
| |
|
||||||| |
|
|
| T |
24096017 |
ggttcac |
24096011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 106 - 161
Target Start/End: Complemental strand, 36098878 - 36098823
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36098878 |
ggttcacggtcggaccggttcgaccggccggtccggtccggtttttaaaactatgg |
36098823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 86 - 160
Target Start/End: Complemental strand, 11733553 - 11733479
Alignment:
| Q |
86 |
accgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||||||| || || || ||||||| |||||||||||||||||| ||||||||||||| ||| ||||||||| |
|
|
| T |
11733553 |
accgaaccggttacccctccggttcacggtcggaccggttcgaccgaccggtccggtccggttttcaaaactatg |
11733479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 69 - 142
Target Start/End: Original strand, 36859040 - 36859113
Alignment:
| Q |
69 |
accgatccaattagtggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggt |
142 |
Q |
| |
|
||||||||||| || |||||||||| || || || ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36859040 |
accgatccaatatgtcaaccgaaccggttacccctccggttcacggtcggaccggttcgaccggccggtccggt |
36859113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 69 - 160
Target Start/End: Original strand, 29984148 - 29984239
Alignment:
| Q |
69 |
accgatccaattagtggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||| || |||||||||| || || || ||||||| ||||||||| ||| |||||||||||||||||| ||| ||||||||| |
|
|
| T |
29984148 |
accgatccaatatgtcaaccgaaccggttacccctccggttcacggtcggaccgattcaaccggccggtccggtccggttttcaaaactatg |
29984239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 118 - 160
Target Start/End: Original strand, 1583219 - 1583261
Alignment:
| Q |
118 |
gaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
1583219 |
gaccggttcaaccggccggtccggtccgatttttaaaactatg |
1583261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 104 - 161
Target Start/End: Complemental strand, 20130637 - 20130580
Alignment:
| Q |
104 |
ctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
||||||| | ||| ||||||||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
20130637 |
ctggttcccggtctgaccggttcaaccggccggtccgatccgatttttaaaactatgg |
20130580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 34258552 - 34258499
Alignment:
| Q |
107 |
gttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||| |||| |||| ||||||||| |
|
|
| T |
34258552 |
gttcacggtcggaccggttcgaccgaccggtccgatccgggtttcaaaactatg |
34258499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 16198026 - 16197972
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||| ||||||||||| | |||||||||||| ||||| |||| ||||||||| |
|
|
| T |
16198026 |
ggttcacggtcggaccggtccaaccggccggtccagtccgggtttcaaaactatg |
16197972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 160
Target Start/End: Complemental strand, 34191004 - 34190958
Alignment:
| Q |
114 |
gtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||| ||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
34191004 |
gtcggatcggttcgaccggccggtccggtctggtttttaaaactatg |
34190958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 161
Target Start/End: Complemental strand, 10991975 - 10991934
Alignment:
| Q |
120 |
ccggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| |||||||||| |
|
|
| T |
10991975 |
ccggttcgaccgaccggtccggtccgggtttcaaaactatgg |
10991934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 104 - 161
Target Start/End: Complemental strand, 44605097 - 44605040
Alignment:
| Q |
104 |
ctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
||||||||| ||| |||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
44605097 |
ctggttcactgtccaaccggtcggaccggccggtccgagccgagttttaaaactatgg |
44605040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 69 - 142
Target Start/End: Original strand, 47424630 - 47424703
Alignment:
| Q |
69 |
accgatccaattagtggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggt |
142 |
Q |
| |
|
||||||||||| || |||||||||| || || || | |||| ||||||||||||||||||||||||||||| |
|
|
| T |
47424630 |
accgatccaatatgtcaaccgaaccggttacccctccgattcatggtcggaccggttcgaccggccggtccggt |
47424703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 114 - 142
Target Start/End: Original strand, 47424408 - 47424436
Alignment:
| Q |
114 |
gtcggaccggttcgaccggccggtccggt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47424408 |
gtcggaccggttcgaccggccggtccggt |
47424436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 3e-24; HSPs: 13)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 198 - 299
Target Start/End: Complemental strand, 814016 - 813915
Alignment:
| Q |
198 |
aattattattgtagaaagaagaatcaattaatcaaatcttgcatgaattaaattaattaaaagttgattaatgcgatgaaaaaatagaacataatcccta |
297 |
Q |
| |
|
|||||| ||||||||||||||||| |||||| |||| | |||| ||| ||||||||||||| ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
814016 |
aattatcattgtagaaagaagaatgaattaaacaaaattcgcattaatcaaattaattaaaatttgattaatgcgatgaaaaaacagaacataaacccta |
813917 |
T |
 |
| Q |
298 |
at |
299 |
Q |
| |
|
|| |
|
|
| T |
813916 |
at |
813915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 108 - 165
Target Start/End: Original strand, 28235715 - 28235772
Alignment:
| Q |
108 |
ttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatggatgt |
165 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
28235715 |
ttcacggtcggaccggttcgaccggccggtccggtccggtttttaaaactatgcatgt |
28235772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 117 - 160
Target Start/End: Complemental strand, 31985195 - 31985152
Alignment:
| Q |
117 |
ggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31985195 |
ggaccggtccgaccggccggtccggtccgagttttaaaactatg |
31985152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 32364977 - 32365031
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
32364977 |
ggttcacggtcggaccggttcgaccggccggtccgagccggtttttaaaactatg |
32365031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 119 - 161
Target Start/End: Original strand, 46546114 - 46546156
Alignment:
| Q |
119 |
accggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
46546114 |
accggttcaaccggtcggtccggtccgagttttaaaactatgg |
46546156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 128 - 160
Target Start/End: Original strand, 42867022 - 42867054
Alignment:
| Q |
128 |
accggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42867022 |
accggccggtccggtccgagttttaaaactatg |
42867054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 43060842 - 43060770
Alignment:
| Q |
7 |
gagtcaccggtttaatccggttctggccgagtttgaccagttcatagtggttcaataacataaccgatccaat |
79 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||| ||| ||| | |||||||||||| ||||||||| |
|
|
| T |
43060842 |
gagtcaccggtttattccggttctggccgagttgcaccgtttcgtagcgagtcaataacataatcgatccaat |
43060770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 107 - 161
Target Start/End: Original strand, 12793608 - 12793662
Alignment:
| Q |
107 |
gttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||| ||| |||||||||| |
|
|
| T |
12793608 |
gttcacggtcggaccggttcgactgaccggtccggtccggttttcaaaactatgg |
12793662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 160
Target Start/End: Original strand, 44258541 - 44258587
Alignment:
| Q |
114 |
gtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||| ||| ||||||||| |
|
|
| T |
44258541 |
gtcggaccggttcaaccggacggtccggtccgattttcaaaactatg |
44258587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 108 - 141
Target Start/End: Original strand, 18033535 - 18033568
Alignment:
| Q |
108 |
ttcacagtcggaccggttcgaccggccggtccgg |
141 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
18033535 |
ttcacggtcggaccggttcgaccggccggtccgg |
18033568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 106 - 139
Target Start/End: Original strand, 20726846 - 20726879
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtcc |
139 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
20726846 |
ggttcacggtcggaccggttcgaccggccggtcc |
20726879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 118 - 158
Target Start/End: Complemental strand, 30787964 - 30787924
Alignment:
| Q |
118 |
gaccggttcgaccggccggtccggtccgagttttaaaacta |
158 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
30787964 |
gaccggttcgaccgaccgatccgatccgagttttaaaacta |
30787924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 128 - 160
Target Start/End: Original strand, 50656386 - 50656418
Alignment:
| Q |
128 |
accggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
50656386 |
accggccgggccggtccgagttttaaaactatg |
50656418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 4e-23; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 78 - 161
Target Start/End: Complemental strand, 12819440 - 12819357
Alignment:
| Q |
78 |
attagtggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
|||| ||||| ||||||||||||| || ||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
12819440 |
attaatggactgaaccggctaaccctccggttcacggtcggaccggttcgactggccgatccggtccgagttttaaaactatgg |
12819357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 58 - 160
Target Start/End: Original strand, 2860254 - 2860352
Alignment:
| Q |
58 |
tcaataacataaccgatccaattagtggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaact |
157 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||| ||||||| ||| |||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2860254 |
tcaatagcataaccgatccaataagtgaaccggaccggcttaccc----gttcacggtcggaccggttcgaccggccggtccgatccgagttttaaaact |
2860349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 106 - 162
Target Start/End: Complemental strand, 41220001 - 41219945
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatgga |
162 |
Q |
| |
|
||||||| |||| |||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
41220001 |
ggttcacggtcgaaccggttcaaccggccgatccggtccgagttttaaaactatgga |
41219945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 117 - 160
Target Start/End: Original strand, 25511479 - 25511522
Alignment:
| Q |
117 |
ggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25511479 |
ggaccggtccgaccggccggtccggtccgagttttaaaactatg |
25511522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 83 - 160
Target Start/End: Complemental strand, 10005162 - 10005086
Alignment:
| Q |
83 |
tggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||||||| ||| ||| ||||| ||||||| |||||||||| ||||| || || |||||||||||||||| |
|
|
| T |
10005162 |
tggaccgaaccggcttacc-tctagttcatggtcggactggttcgaccgaccggttcgttctgagttttaaaactatg |
10005086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 119 - 160
Target Start/End: Original strand, 41867736 - 41867777
Alignment:
| Q |
119 |
accggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
41867736 |
accggttcgaccggccagtccggtccgggttttaaaactatg |
41867777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 44352851 - 44352884
Alignment:
| Q |
128 |
accggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44352851 |
accggccggtccggtccgagttttaaaactatgg |
44352884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 4e-17; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 23 - 100
Target Start/End: Complemental strand, 4454584 - 4454507
Alignment:
| Q |
23 |
ccggttctggccgagtttgaccagttcatagtggttcaataacataaccgatccaattagtggaccgaaccggctaac |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||| | |||||||||||||| ||||| |||| ||||||||| |||||||||| |
|
|
| T |
4454584 |
ccggttctggccgagtttgaccggttcacaacggttcaataacatatccgattcaataagtggaccggaccggctaac |
4454507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 40484743 - 40484689
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40484743 |
ggttcacggtcggaccggttcgaccggccggtccggtccggtttttaaaactatg |
40484689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 106 - 159
Target Start/End: Original strand, 14910919 - 14910972
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactat |
159 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||| ||| |||||||| |
|
|
| T |
14910919 |
ggttcacggtcggaccggttcgaccggccggtccgatccggttttcaaaactat |
14910972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 116 - 160
Target Start/End: Original strand, 9457413 - 9457457
Alignment:
| Q |
116 |
cggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||||||||||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
9457413 |
cggaccggttcgaccgcccggtccgatccgatttttaaaactatg |
9457457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 128 - 160
Target Start/End: Original strand, 42064207 - 42064239
Alignment:
| Q |
128 |
accggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42064207 |
accggccggtccggtccgagttttaaaactatg |
42064239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 3656573 - 3656627
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccggtccgagtttt-aaaactatg |
160 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||| |||||| ||||||||| |
|
|
| T |
3656573 |
ggttcacggtcggaccggttcaaccggccggtccggtcc-agttttcaaaactatg |
3656627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 160
Target Start/End: Complemental strand, 13486501 - 13486455
Alignment:
| Q |
114 |
gtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||| ||||||||| |
|
|
| T |
13486501 |
gtcggaccggttcaaccggccggtccggtccgcttttcaaaactatg |
13486455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 126 - 160
Target Start/End: Original strand, 14269916 - 14269950
Alignment:
| Q |
126 |
cgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
14269916 |
cgactggccggtccggtccgagttttaaaactatg |
14269950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 160
Target Start/End: Complemental strand, 27678605 - 27678559
Alignment:
| Q |
114 |
gtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||| ||||||||| |
|
|
| T |
27678605 |
gtcggaccggttcaaccggccggtccggtccggttttcaaaactatg |
27678559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 127 - 161
Target Start/End: Complemental strand, 27844989 - 27844955
Alignment:
| Q |
127 |
gaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27844989 |
gaccggccggtccggtccgggttttaaaactatgg |
27844955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 6e-16; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 69 - 160
Target Start/End: Complemental strand, 22350562 - 22350471
Alignment:
| Q |
69 |
accgatccaattagtggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||| || |||||||||| || || || ||||||| |||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
22350562 |
accgatccaatatgtcaaccgaaccggttacccctccggttcacggtcggaccggttcgaccggccggtccggtccggttttcaaaactatg |
22350471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 121 - 160
Target Start/End: Complemental strand, 29291685 - 29291646
Alignment:
| Q |
121 |
cggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29291685 |
cggttcaaccggccggtccggtccgagttttaaaactatg |
29291646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 121 - 161
Target Start/End: Complemental strand, 24067357 - 24067317
Alignment:
| Q |
121 |
cggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
24067357 |
cggttcgaccggccggtccggtccgattttcaaaactatgg |
24067317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 88 - 163
Target Start/End: Original strand, 24431498 - 24431573
Alignment:
| Q |
88 |
cgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatggat |
163 |
Q |
| |
|
|||||||||| ||| ||||||||| ||| ||| ||| |||||||||||||| |||||||| |||||||||||| |
|
|
| T |
24431498 |
cgaaccggcttacccactggttcacggtccgactggtctgaccggccggtccgtgccgagtttcaaaactatggat |
24431573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 160
Target Start/End: Complemental strand, 21528145 - 21528099
Alignment:
| Q |
114 |
gtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||| ||||||||| |
|
|
| T |
21528145 |
gtcggaccggttgaaccggccggtccggtccgggtttcaaaactatg |
21528099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 86 - 160
Target Start/End: Complemental strand, 29523196 - 29523122
Alignment:
| Q |
86 |
accgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||||||| || ||||| ||||||| ||||||||||||||||| |||||||||||||| ||| ||||||||| |
|
|
| T |
29523196 |
accgaaccggttacccatccggttcacggtcggaccggttcgaccagccggtccggtccggttttcaaaactatg |
29523122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 33 - 161
Target Start/End: Complemental strand, 30962295 - 30962169
Alignment:
| Q |
33 |
ccgagtttgaccagttcatagtggttcaataacataaccgatccaattagtggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccgg |
132 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||| ||| ||||| || | |||||| || |||||| | ||||||| |||||||| ||| || || |
|
|
| T |
30962295 |
ccgagtttgaccgattcatagaggttcaataacataatcgacccaataagcgaaccgaatcgactaacccaccggttcacggtcggacc--ttcaactgg |
30962198 |
T |
 |
| Q |
133 |
ccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
||||| ||||| |||||||||| |||||| |
|
|
| T |
30962197 |
ccggttcggtctgagttttaaatctatgg |
30962169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 86 - 160
Target Start/End: Original strand, 18541487 - 18541561
Alignment:
| Q |
86 |
accgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||||||| || || || ||||||| ||||||| |||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
18541487 |
accgaaccggttacccctccggttcacggtcggactggttcgaccggccggtccggtccggttttcaaaactatg |
18541561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 116 - 160
Target Start/End: Complemental strand, 19262330 - 19262286
Alignment:
| Q |
116 |
cggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19262330 |
cggaccggctcgaccggccggtccggtccgatttttaaaactatg |
19262286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 86 - 160
Target Start/End: Complemental strand, 39061235 - 39061161
Alignment:
| Q |
86 |
accgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||||||| || || || ||||||| |||||||| ||||||||||||||||| ||||| ||| ||||||||| |
|
|
| T |
39061235 |
accgaaccggttacccctccggttcacggtcggaccagttcgaccggccggtccagtccggttttcaaaactatg |
39061161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 162
Target Start/End: Original strand, 7502182 - 7502230
Alignment:
| Q |
114 |
gtcggaccggttcgaccggccggtccggtccgagttttaaaactatgga |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||| ||||||||||| |
|
|
| T |
7502182 |
gtcggaccggttgaaccggccggtccggtccgggtttcaaaactatgga |
7502230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 118 - 161
Target Start/End: Original strand, 3989764 - 3989807
Alignment:
| Q |
118 |
gaccggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
3989764 |
gaccggtccgaccggccggtccggtccggtttttaaaactatgg |
3989807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 69 - 160
Target Start/End: Original strand, 7154338 - 7154429
Alignment:
| Q |
69 |
accgatccaattagtggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||| || |||||||||| || || || ||||||| |||||||||||||||||||||| || ||||| ||| ||||||||| |
|
|
| T |
7154338 |
accgatccaatatgtcaaccgaaccggttacccctccggttcacggtcggaccggttcgaccggccgatctagtccggttttcaaaactatg |
7154429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 69 - 160
Target Start/End: Original strand, 31901772 - 31901863
Alignment:
| Q |
69 |
accgatccaattagtggaccgaaccggctaaccatctggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||| || ||||||||| || || || ||||||| ||||||||||| |||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
31901772 |
accgatccaatatgtcaaccgaaccgattatccctccggttcacggtcggaccggtccgaccggccgatccggtccggttttcaaaactatg |
31901863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 127 - 161
Target Start/End: Complemental strand, 23292349 - 23292315
Alignment:
| Q |
127 |
gaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
23292349 |
gaccggccggtcaggtccgagttttaaaactatgg |
23292315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 114 - 160
Target Start/End: Complemental strand, 37314273 - 37314227
Alignment:
| Q |
114 |
gtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||| ||||||||| |
|
|
| T |
37314273 |
gtcggaccggttcaaccggccggtccggtccggttttcaaaactatg |
37314227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 160
Target Start/End: Original strand, 12341198 - 12341239
Alignment:
| Q |
119 |
accggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
12341198 |
accggttcgaccggccggtccgagccgggttttaaaactatg |
12341239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0131 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0131
Description:
Target: scaffold0131; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 106 - 161
Target Start/End: Complemental strand, 7251 - 7196
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatgg |
161 |
Q |
| |
|
||||||| ||| ||| ||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
7251 |
ggttcacggtccgacgggttcaaccggacggtccggtccgagttttaaaactatgg |
7196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 52713 - 52767
Alignment:
| Q |
106 |
ggttcacagtcggaccggttcgaccggccggtccggtccgagttttaaaactatg |
160 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||||| |||| ||||||||||||| |
|
|
| T |
52713 |
ggttcacggtcggaccggttcaaccggtcggtccgatccggtttttaaaactatg |
52767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University