View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2209_low_19 (Length: 256)
Name: NF2209_low_19
Description: NF2209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2209_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 176 - 239
Target Start/End: Original strand, 27701877 - 27701940
Alignment:
| Q |
176 |
acaaagaacctttgtgaaataagaacaaaatcactctatagtttcaagctgttcattcttctca |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27701877 |
acaaagaacctttgtgaaataagaacaaaatcactctatagtttcaagctgttcattcttctca |
27701940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 27701706 - 27701740
Alignment:
| Q |
1 |
taaaatgctactgtcttcagtgcatagaagacatg |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27701706 |
taaaatgctactgtcttcagtgcatagaagacatg |
27701740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University