View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2209_low_22 (Length: 250)
Name: NF2209_low_22
Description: NF2209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2209_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 30 - 168
Target Start/End: Complemental strand, 51738473 - 51738335
Alignment:
| Q |
30 |
cctttacagttatgcaaattgaggatattcaagcatctaaagccattagcaataatagcaagatcagaatcagtaacaccaggatggaacgaacgagaaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51738473 |
cctttacagttatgcaaattgaggatcctcaagcatctaaagccattagcaataacagcaagatcagaatcagtaacaccaggatagaacgaacgagaaa |
51738374 |
T |
|
| Q |
130 |
tagactgagcaaggtccaattcaaccaagcgtgtgaacc |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51738373 |
tagactgagcaaggtccaattcaaccaagcgtgtgaacc |
51738335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 167 - 211
Target Start/End: Complemental strand, 2597373 - 2597329
Alignment:
| Q |
167 |
ccctctaataacctttaattaaataataacctccccttgtatctt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2597373 |
ccctctaataacctttaattaaataataaccttcccttgtatctt |
2597329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University