View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2209_low_24 (Length: 234)
Name: NF2209_low_24
Description: NF2209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2209_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 27079857 - 27079643
Alignment:
| Q |
1 |
aaaggtgctgatgcggatcataaggtaacattcaaaggttatggtgttaataacacgtttaaggattacgataaaaaaggtatttcttttgccggttata |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27079857 |
aaaggtgctgatgcggatcataagataacattcaaaggttatggtgttaataacacgtttaaggattacgataaaaaaggtatttcttttgctggttata |
27079758 |
T |
 |
| Q |
101 |
ctaagaaatcttcttcttcaacaaattctgttagtgaaagtgttagtttggcnnnnnnntgggttcaacctggtaagtttttccgggaaaagatgttgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27079757 |
ctaagaaatcttcttcttcaacaaattctgttagtgaaagtgttagtttggcaaaaaaatgggttcaacctggtaagtttttccgagaaaagatgttgaa |
27079658 |
T |
 |
| Q |
201 |
acaaggggtggttat |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27079657 |
acaaggggtggttat |
27079643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 200
Target Start/End: Complemental strand, 27066090 - 27065941
Alignment:
| Q |
48 |
taataacacgtttaaggattacgataaaaaaggtatttcttttgccggttatactaagaaatcttcttcttcaacaaattctgttagtgaaagtgttagt |
147 |
Q |
| |
|
|||||| || ||||||||||| || || ||||||||||||||||| |||||| ||| | || || ||||||| || ||| | ||||| |||| |||| |
|
|
| T |
27066090 |
taataatacatttaaggattatgacaagaaaggtatttcttttgctagttataataaaa---ctactacttcaactaactctctcagtgatagtggtagt |
27065994 |
T |
 |
| Q |
148 |
ttggcnnnnnnntgggttcaacctggtaagtttttccgggaaaagatgttgaa |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27065993 |
ttggcaaaaaacatggttcaacctggtaagtttttccgggagaagatgttgaa |
27065941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University