View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2210R-Insertion-2 (Length: 43)

Name: NF2210R-Insertion-2
Description: NF2210R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2210R-Insertion-2
NF2210R-Insertion-2
[»] chr5 (1 HSPs)
chr5 (9-43)||(29199429-29199463)
[»] chr4 (1 HSPs)
chr4 (9-43)||(12652442-12652476)


Alignment Details
Target: chr5 (Bit Score: 35; Significance: 0.00000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 9 - 43
Target Start/End: Original strand, 29199429 - 29199463
Alignment:
9 ccttccataactgaaaatcaaatcccgcttttctc 43  Q
    |||||||||||||||||||||||||||||||||||    
29199429 ccttccataactgaaaatcaaatcccgcttttctc 29199463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 9 - 43
Target Start/End: Complemental strand, 12652476 - 12652442
Alignment:
9 ccttccataactgaaaatcaaatcccgcttttctc 43  Q
    |||||||||||||||||||||||||||||||||||    
12652476 ccttccataactgaaaatcaaatcccgcttttctc 12652442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University