View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2210R-Insertion-2 (Length: 43)
Name: NF2210R-Insertion-2
Description: NF2210R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2210R-Insertion-2 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 35; Significance: 0.00000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 9 - 43
Target Start/End: Original strand, 29199429 - 29199463
Alignment:
| Q |
9 |
ccttccataactgaaaatcaaatcccgcttttctc |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
29199429 |
ccttccataactgaaaatcaaatcccgcttttctc |
29199463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 9 - 43
Target Start/End: Complemental strand, 12652476 - 12652442
Alignment:
| Q |
9 |
ccttccataactgaaaatcaaatcccgcttttctc |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12652476 |
ccttccataactgaaaatcaaatcccgcttttctc |
12652442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University