View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2210R-Insertion-4 (Length: 96)
Name: NF2210R-Insertion-4
Description: NF2210R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2210R-Insertion-4 |
 | |
|
| [»] chr5 (4 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 2e-43; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 41437370 - 41437458
Alignment:
| Q |
8 |
aaaatccaactttacctttctccctttcttcttcttgaacgagttggccttgcggttcgcctttatcatctgctttaccattttgctca |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41437370 |
aaaatccaactttacctttctccctttcttcttcttgaacgagttggccttgcggttcgcctttatcatctgctttaccattttgctca |
41437458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 41450596 - 41450684
Alignment:
| Q |
8 |
aaaatccaactttacctttctccctttcttcttcttgaacgagttggccttgcggttcgcctttatcatctgctttaccattttgctca |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41450596 |
aaaatccaactttacctttctccctttcttcttcttgaacgagttggccttgcggttcgcctttatcatctgctttaccattttgctca |
41450684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 73; E-Value: 6e-34
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 14239521 - 14239609
Alignment:
| Q |
8 |
aaaatccaactttacctttctccctttcttcttcttgaacgagttggccttgcggttcgcctttatcatctgctttaccattttgctca |
96 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
14239521 |
aaaatccaactttacctttttccctttcttcttcttgaacgagttggccttgtggttcgcctttatcacctgatttaccattttgctca |
14239609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 58; E-Value: 6e-25
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 14373828 - 14373743
Alignment:
| Q |
8 |
aaaatccaactttacctttctccctttcttcttcttgaacgagttggccttgcggttcgcctttatcatctgctttaccattttgc |
93 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||| || |||||||| |||||||||||||||||||||||| |
|
|
| T |
14373828 |
aaaacccaactttacctttctccctttcttcttcttgaacaagttggtttttcggttcgctattatcatctgctttaccattttgc |
14373743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 22749525 - 22749575
Alignment:
| Q |
8 |
aaaatccaactttacctttctccctttcttcttcttgaacgagttggcctt |
58 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||||| ||||| |||| |
|
|
| T |
22749525 |
aaaacccaactttaccttgctctctttcttcttcttgaacaagttgtcctt |
22749575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University