View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2210R-Insertion-6 (Length: 307)
Name: NF2210R-Insertion-6
Description: NF2210R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2210R-Insertion-6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 35163932 - 35163808
Alignment:
| Q |
8 |
acatcggttgttgataagaggtcagtgatgtaaagtgaggtggaagttgcagtgatgaaatcgacgccggcgtcgttgcaagtcaggtaaacatagccct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163932 |
acatcggttgttgataagaggtcagtgatgtaaagtgaggtggaagttgcagtgatgaaatcgacgccggcgtcgttgcaagtcaggtaaacatagccct |
35163833 |
T |
|
| Q |
108 |
cagagtcggtggttaaacgaccggc |
132 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35163832 |
cagagtcggtggttaaacgaccggc |
35163808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 186 - 307
Target Start/End: Complemental strand, 35163754 - 35163633
Alignment:
| Q |
186 |
ttaaaatatggaaaggaatgtttgaaggttttgtgaagagacaacctttttggatgtagtgacaagacaacataggtaggtctgaaacagagagtttaag |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163754 |
ttaaaatatggaaaggaatgtttgaaggttttgtgaagagacaacctttttggatgtagtgacaagacaacataggtaggtctgaaacagagagtttaag |
35163655 |
T |
|
| Q |
286 |
gtttgctatgttggatttttgg |
307 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35163654 |
gtttgctatgttggatttttgg |
35163633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University