View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2210_high_21 (Length: 367)
Name: NF2210_high_21
Description: NF2210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2210_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 194 - 360
Target Start/End: Original strand, 35657827 - 35657993
Alignment:
| Q |
194 |
gaacagcagcaatcctccttccaggcatctttgggttgggaatttatcacacagtattgtagaggatgagcttgcgcatccttttatacggtttggaccg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35657827 |
gaacagcagcaatcctccttccaggcatctttgggttgggaatttatcacacaatattgtagaggatgagcttgcgcatccttttatacggtttggaccg |
35657926 |
T |
 |
| Q |
294 |
ttggaaaaagttgcgtttcagcctgggagaagctatgctttcatcaattttgaagtggatgatgatg |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35657927 |
ttggaaaaagttgcgtttcagcctgggagaagctatgctttcatcaattttgaagtggatgaagatg |
35657993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 71 - 145
Target Start/End: Original strand, 35657719 - 35657793
Alignment:
| Q |
71 |
gcaatagtcaagtcgaggtggaagggatcgatccagaagggattatccggcaagatacgaagacaataaagggaa |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
35657719 |
gcaatagtcaagtcgaggtggaagggatcgatccagaagggattatctggcaagatatgaagacaataaagggaa |
35657793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 35657649 - 35657682
Alignment:
| Q |
1 |
tatataaagtagaaaacttgattataatttacta |
34 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
35657649 |
tatataaagtagaaaacttgatgataatttacta |
35657682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University