View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2210_high_24 (Length: 330)
Name: NF2210_high_24
Description: NF2210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2210_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 197 - 322
Target Start/End: Complemental strand, 35163754 - 35163629
Alignment:
| Q |
197 |
ttaaaatatggaaaggaatgtttgaaggttttgtgaagagacaacctttttggatgtagtgacaagacaacataggtaggtctgaaacagagagtttaag |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163754 |
ttaaaatatggaaaggaatgtttgaaggttttgtgaagagacaacctttttggatgtagtgacaagacaacataggtaggtctgaaacagagagtttaag |
35163655 |
T |
 |
| Q |
297 |
gtttgctatgttggatttttggtctg |
322 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35163654 |
gtttgctatgttggatttttggtctg |
35163629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 19 - 143
Target Start/End: Complemental strand, 35163932 - 35163808
Alignment:
| Q |
19 |
acatcggttgttgataagaggtcagtgatgtaaagtgaggtggaagttgcagtgatgaaatcgacgccggcgtcgttgcaagtcaggtaaacatagccct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163932 |
acatcggttgttgataagaggtcagtgatgtaaagtgaggtggaagttgcagtgatgaaatcgacgccggcgtcgttgcaagtcaggtaaacatagccct |
35163833 |
T |
 |
| Q |
119 |
cagagtcggtggttaaacgaccggc |
143 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35163832 |
cagagtcggtggttaaacgaccggc |
35163808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University