View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2210_high_41 (Length: 244)
Name: NF2210_high_41
Description: NF2210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2210_high_41 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 244
Target Start/End: Original strand, 54135390 - 54135621
Alignment:
| Q |
14 |
agatcaaaggttttggccccaattacaggaatttaattcaaggtctgtttagactgggggtttaggaatgaaattaaagatagaaaagccatattgtgct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
54135390 |
agatcaaaggttttggccccaattacaggaatttaattcaaggtctgtttagactgggggtttaggaacgaaattaaagatagaaaagccatattgtggt |
54135489 |
T |
 |
| Q |
114 |
cgggactcttgt-aaatgagaagcgaatgggggatttaataagaatacaattcactcaacccttataaatgttatcccgtcaaaaaatattgtaaatgtg |
212 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54135490 |
cgggactcttgtaaaatgagaagcgaatgggggatttgataagaatacaattcactcaacccttatgaatgttatcccgtcaaaaaatattgtaaatgtg |
54135589 |
T |
 |
| Q |
213 |
ttttggcagatcattcaaatttaattagtcat |
244 |
Q |
| |
|
|||||| | ||||||||||||||||||||||| |
|
|
| T |
54135590 |
ttttggaaaatcattcaaatttaattagtcat |
54135621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University