View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2210_high_45 (Length: 235)
Name: NF2210_high_45
Description: NF2210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2210_high_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 3 - 224
Target Start/End: Original strand, 2370219 - 2370440
Alignment:
| Q |
3 |
gcaatgttgcttgctgcactgttctgcaatctagttaactattaactatagagtatggggtgtggatattgaatttgatgcagctacaaggtggagtaag |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2370219 |
gcaatgttgcttgctgcactgttctgcaatctagttaactattaactatagagtatggggtatggatattgaatttgatgcagctacaaggtggagtaag |
2370318 |
T |
 |
| Q |
103 |
ttagggaccaactatatattggacaaatacaaatataattggaatccaggattgggttagactttctgtgtaagaaaaatgctaggagtgtgagggagag |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2370319 |
ttagggaccaactatatattggacaaatacaaatataattggaatccaggattgggttagactttatgtgtaagaaaaatgctaggagtgtgagggagag |
2370418 |
T |
 |
| Q |
203 |
aaatagttacaaatacttgatg |
224 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
2370419 |
aaataattacaaatacttgatg |
2370440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University