View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2210_low_25 (Length: 325)
Name: NF2210_low_25
Description: NF2210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2210_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 314
Target Start/End: Original strand, 44391885 - 44392185
Alignment:
| Q |
19 |
ttttgacaaataattccacaaaagggcattttataacttcaccaagttcttctattgttccttcaaaaataaaagttcttctactattttacactttcac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
44391885 |
ttttgacaaataattccacaaaagggcattttataacttcaccaagttcttctattgttccttcaaaaacaaaagttcttctaccattttacactttcac |
44391984 |
T |
 |
| Q |
119 |
ttttactacatagtacatgcacaaagggaccatgcaataaatgtcttcnnnnnnnntaaaagtagctttggattataattgatgccaaaatttgtaatct |
218 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44391985 |
ttttactacat-gtacatgcacaaagggaccatgcagtaaatgtcttc-aaaaaaataaaagtggctttggattataattgatgccaaaatttgtaatct |
44392082 |
T |
 |
| Q |
219 |
gtcagtgggtcggcagtgttttagaggctggcctgattt-------aaagctcccccaccaccatgtggctatgttgtattgtatctggtcattttaatt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44392083 |
gtcagtgggtcggcagtgttttagaggctggcctgatttcggactcaaagctcccccaccaccatgtggctatgttgtattgtatctggtcattttaatt |
44392182 |
T |
 |
| Q |
312 |
ctt |
314 |
Q |
| |
|
||| |
|
|
| T |
44392183 |
ctt |
44392185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University