View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2210_low_34 (Length: 294)
Name: NF2210_low_34
Description: NF2210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2210_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 2484415 - 2484558
Alignment:
| Q |
1 |
tttctgattgattgtccctctctgttggtctcttcttcatacttttgaatgattgtatctctccctcttggtttcttcttctgattgattggattgcttc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2484415 |
tttctcattgattgtccctctctgttggtctcttcttcattcttttgattgattgtatctctccctcttgatttcttcttctgattgattggattgcttc |
2484514 |
T |
|
| Q |
101 |
tccctgttttgattcttctaattgattgcttctctcccttttta |
144 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
2484515 |
tccctgttttgattcttctaattgattgtttctcccccttttta |
2484558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 92 - 142
Target Start/End: Complemental strand, 11828434 - 11828384
Alignment:
| Q |
92 |
gattgcttctccctgttttgattcttctaattgattgcttctctccctttt |
142 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
11828434 |
gattgcttctcccccttttgattcttttaattgattgcttctttccctttt |
11828384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 109 - 142
Target Start/End: Original strand, 8574429 - 8574462
Alignment:
| Q |
109 |
ttgattcttctaattgattgcttctctccctttt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8574429 |
ttgattcttctaattgattgcttctctccctttt |
8574462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University