View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2210_low_36 (Length: 280)
Name: NF2210_low_36
Description: NF2210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2210_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 102 - 262
Target Start/End: Complemental strand, 49933854 - 49933694
Alignment:
| Q |
102 |
acacattatccttattcaatatcacacttgtcagtggccaggttgactcccagttgcaaataactggttcagtattgcaaccaatcatttctggaaacgt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49933854 |
acacattatccttattcaatatcacacttgtcagtggccaggttgactcccagttgcaaataactggttcagtattgcaaccaatcatttctggaaacgt |
49933755 |
T |
 |
| Q |
202 |
taaacttagtaatggagaagtatatttgccacacgatgggggcaatggtgatagtcaaaca |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49933754 |
taaacttagtaatggagaagtatatttgccacacgatgggggcaatggtgatagtcaaaca |
49933694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 49933955 - 49933885
Alignment:
| Q |
1 |
gttgctttcttagttgttggtgtacgtatatatgataattgaatctaaaatattattgagttttggcaata |
71 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49933955 |
gttgctttcttagttgttggtgtacgtagatatgataattgaatcaaaaatattattgagttttggcaata |
49933885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 133 - 234
Target Start/End: Original strand, 1914618 - 1914719
Alignment:
| Q |
133 |
cagtggccaggttgactcccagttgcaaataactggttcagtattgcaaccaatcatttctggaaacgttaaacttagtaatggagaagtatatttgcca |
232 |
Q |
| |
|
|||||| |||||||| || || ||||||||||||||||| |||||||||||| ||| ||||| || | ||| | ||| | ||||||| |||||||||| |
|
|
| T |
1914618 |
cagtggtcaggttgattctcaactgcaaataactggttcaatattgcaaccaaacatatctgggaatatcaaattaagtcacggagaagcatatttgcca |
1914717 |
T |
 |
| Q |
233 |
ca |
234 |
Q |
| |
|
|| |
|
|
| T |
1914718 |
ca |
1914719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University