View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2210_low_39 (Length: 253)
Name: NF2210_low_39
Description: NF2210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2210_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 8840174 - 8840404
Alignment:
| Q |
1 |
aagcttaaaatgtaaaaattaattagcaatcgtcatatttttctctgcaatgcgattattatgacgtttttagaggtctctgcaatcacatcgcaaccac |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8840174 |
aagcttaaaatgtaaaaactaattagcaatcgtcatatttttctccgcaatgcgattattatgacgtttttagaggtctctgcaatcacattgcaaccac |
8840273 |
T |
|
| Q |
101 |
aattttagtcacatcaattgcatgcatgtgtctagaaacaaattctatacaagttttggaggcgtccgcaaccacattgcaatttttcgcaatgtcaaga |
200 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8840274 |
aattttagtcatatcaatagcatgcatgtgtctagaaacaaattctatacatgttttggaggcgtccgcaaccacattgcaatttttcgcgatgtcaaga |
8840373 |
T |
|
| Q |
201 |
atatttgacatacacaatttaaaatatttga |
231 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |
|
|
| T |
8840374 |
atatttgacatgcacaatttaaaatatttga |
8840404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University