View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2210_low_45 (Length: 240)
Name: NF2210_low_45
Description: NF2210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2210_low_45 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 97 - 223
Target Start/End: Complemental strand, 32325544 - 32325417
Alignment:
| Q |
97 |
tctagtactgcatttaagttttgcccatattcaaatcctatgttcttttttcttannnnnnnnn--ctctatttacaaattaacaagtgcttttgatttg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |||||||||| |
|
|
| T |
32325544 |
tctagtactgcatttaagttttgcccatattcaaatcctatgttctttttttttttttttttttttctctatttacaaattaacaagtgattttgatttg |
32325445 |
T |
|
| Q |
195 |
attttttggtgaattaaaatatatcagat |
223 |
Q |
| |
|
|| |||||||||||||||||||||||||| |
|
|
| T |
32325444 |
at-ttttggtgaattaaaatatatcagat |
32325417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University