View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2210_low_49 (Length: 232)
Name: NF2210_low_49
Description: NF2210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2210_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 34248740 - 34248523
Alignment:
| Q |
1 |
gaaaggcatgttatatatagtagtgataggaatcaaatatatagtttgagtggcataccttaatgttgacggaggtttgtggttggttcacttggaaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34248740 |
gaaaggcatgttatatatagtagtgataggaatcaaatatatagtttgagtggcataccttaatgttgacggaggtttgtggttggttcacttggaaaag |
34248641 |
T |
|
| Q |
101 |
aaggagtgattgcttgtacttgtagtgtaaaatgaaaatggggagtttttgtttggctatgattgaccttaggagttaggtctatc--tagtacaccttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
34248640 |
aaggagtgattgcttgtacttgtagtgtaaaatgaaaatggggagtttttgtttggctatgattgaccttaggagttaggtctatctatagtacactttt |
34248541 |
T |
|
| Q |
199 |
atgaccttaattaatgtt |
216 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34248540 |
atgaccttaattaatgtt |
34248523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 86 - 188
Target Start/End: Complemental strand, 34257741 - 34257641
Alignment:
| Q |
86 |
gttcacttggaaaagaaggagtgattgcttgtacttgtagtgtaaaatgaaaatggggagtttttgtttggctatgattgaccttaggagttaggtctat |
185 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||| |
|
|
| T |
34257741 |
gttcacttggaaaagacggagtgcttgcttg--cttgtagtgtaaaatgaaaatggggagtttttgtttggcaatgcctgaccttagaagttaggtctat |
34257644 |
T |
|
| Q |
186 |
cta |
188 |
Q |
| |
|
||| |
|
|
| T |
34257643 |
cta |
34257641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University