View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2211_high_14 (Length: 368)
Name: NF2211_high_14
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2211_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 34771830 - 34772023
Alignment:
| Q |
1 |
gaatctgggatggttggttgttatgagttataattttgttaatcttattttgtttcagcttatgaaagggaaagacatgagatgacctgcttgtgcaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34771830 |
gaatctgggatggttggttgttatgagttataattttgttaatcttattttgtttcagcttatgaaagggaaagacatgagatgacctgcttgtgcaatt |
34771929 |
T |
 |
| Q |
101 |
ataatgatggatggtgcttgtcttgcaaagaaaatcatgaaaagccaaaaaagtcatggcagcaagaagagagggaagctggtgatgaagtagc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34771930 |
ataatgatggatggtgcttgtcttgcaaagaaaatcatgaaaagccaaaaaagtcatggcagcaagaagagagggaagctggtgatgaagtagc |
34772023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 284 - 368
Target Start/End: Original strand, 34772113 - 34772197
Alignment:
| Q |
284 |
ggttggatgagttgaagaagaatagaatgaggtttgaagtttctttagatttgtgggaagctatgagtgaagatgaaaagttagt |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34772113 |
ggttggatgagttgaagaagaatagaatgaggtttgaagtttctttagatttgtgggaagctatgagtgaagatgaaaagttagt |
34772197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University