View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2211_high_34 (Length: 262)
Name: NF2211_high_34
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2211_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 9037319 - 9037543
Alignment:
| Q |
17 |
cacaatatggcatctccaatgccactataaaaaggcacaacatggttttctaatcatatcatcataattctatacaactctatatnnnnnnnnnnnnnnn |
116 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9037319 |
cacaatatggcatctccaatgc-actataaaaaggcacaacatggttttctaatcatatcatcataattctatacaattctatagagagagagagagaga |
9037417 |
T |
 |
| Q |
117 |
----atgatggcaattaggttttcattagctactcttctgttcatgttcatcattggttttagtatttcagaccttacaccaacaccatccccaaacctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9037418 |
gagaatgatggcaattaggttttcattagctaatcttctgttcatgttcatcattggttttagtatttcagaccttacaccaacaccatccccaaacctt |
9037517 |
T |
 |
| Q |
213 |
gtcaagaaaaaacctccatctcgatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
9037518 |
gtcaagaaaaaacctccatctcgatt |
9037543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University