View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2211_high_39 (Length: 250)
Name: NF2211_high_39
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2211_high_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 13484965 - 13485046
Alignment:
| Q |
1 |
atagcaacaacggattcaacaaaccaatagatcctatcaaagtaagattcctcaacatgaagcacatgagaaacacatagta |
82 |
Q |
| |
|
|||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13484965 |
atagcaacaacggatttaaacagtcaatagatcctatcaaagtaagattcctcaacatgaagcacatcagaaacacatagta |
13485046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University