View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2211_high_40 (Length: 249)

Name: NF2211_high_40
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2211_high_40
NF2211_high_40
[»] chr2 (1 HSPs)
chr2 (1-241)||(26808433-26808671)


Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 26808671 - 26808433
Alignment:
1 ttaacagttaatactcacttttcagtgccaaatattgtaatagtatcaaactggaatctgagtttaaaaataatgcaagatgtctatggaagtaaaaaat 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26808671 ttaacaattaatactcacttttcagtgccaaatattgtaatagtatcaaactggaatctgagtttaaaaataatgcaagatgtctatggaagtaaaaaat 26808572  T
101 gtgtatagggtgtattggaatctgtaccaattggaacaatggatctgtcaaaaagaaaaggaaggacgaaatccatattttgattttctccattaaacaa 200  Q
    |||||  ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
26808571 gtgta--gggtgtattggaatctgtaccaattggaacaatagatctgtcaaaaagaaaaggaaggaagaaatccatattttgattttctccattaaacaa 26808474  T
201 gtcactaataccaaacattgatgtcagtttatccctttgct 241  Q
    |||||||||||||||||||||||||||||||||||||||||    
26808473 gtcactaataccaaacattgatgtcagtttatccctttgct 26808433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University