View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2211_high_41 (Length: 247)
Name: NF2211_high_41
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2211_high_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 95 - 229
Target Start/End: Original strand, 47349557 - 47349691
Alignment:
| Q |
95 |
catcccaaatgctctgaatctgtgccacgtgtctcttcaaactggtgggaaacactatttaggacccttcgcgttgatcgacaagattaatagccacgag |
194 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47349557 |
catcccaaatgctccgaatctctgccacgtgtctcttcaaactggtgggaaacactatttaggacccttcgcgttgatcgacaagattaatagccacgag |
47349656 |
T |
 |
| Q |
195 |
ccgccctttacggaggatctaccgcgtttggatat |
229 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47349657 |
ccgtcctttacggaggatctaccgcgtttggatat |
47349691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 47341642 - 47341728
Alignment:
| Q |
1 |
acagggtaacactcaataaaggaaggggcgattaaatgtggcaaaannnnnnntgattttatgactcgggactcgagttagctgtta |
87 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
47341642 |
acagggtgacactcaataaaggaaggggcggttaaatgtggcaaaaccccccctaattttatgactcgggactcgagttaactgtta |
47341728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 96 - 223
Target Start/End: Original strand, 47347019 - 47347146
Alignment:
| Q |
96 |
atcccaaatgctctgaatctgtgccacgtgtctcttcaaactggtgggaaacactatttaggacccttcgcgttgatcgacaagattaatagccacgagc |
195 |
Q |
| |
|
|||||||| || | |||||| |||||||||| |||||||| ||||| ||||||||||||||||| || | |||||| ||||||||||| || |||| |
|
|
| T |
47347019 |
atcccaaacgcaccgaatctccgccacgtgtcacttcaaaccggtggaaaacactatttaggaccgtttgatctgatcgggaagattaatagtcatgagc |
47347118 |
T |
 |
| Q |
196 |
cgccctttacggaggatctaccgcgttt |
223 |
Q |
| |
|
|||| || ||||||||| |||||||||| |
|
|
| T |
47347119 |
cgccgttcacggaggatttaccgcgttt |
47347146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 165
Target Start/End: Complemental strand, 5401520 - 5401451
Alignment:
| Q |
96 |
atcccaaatgctctgaatctgtgccacgtgtctcttcaaactggtgggaaacactatttaggacccttcg |
165 |
Q |
| |
|
||||||||||||| ||||| | ||| ||||||||||| ||||||| || |||||| |||||||||||| |
|
|
| T |
5401520 |
atcccaaatgctccaaatctttcccatgtgtctcttcagactggtgccaagcactatgtaggacccttcg |
5401451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University