View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2211_high_44 (Length: 238)
Name: NF2211_high_44
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2211_high_44 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 17 - 81
Target Start/End: Original strand, 1971679 - 1971743
Alignment:
| Q |
17 |
atgaaggaagcttttgggtctgttggagctttgtttatcgcggtgagttttgtttatttttaatt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1971679 |
atgaaggaagcttttgggtctgttggagctttgtttatcgcggtgagttttgtttatttttaatt |
1971743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 17 - 81
Target Start/End: Original strand, 19962661 - 19962725
Alignment:
| Q |
17 |
atgaaggaagcttttgggtctgttggagctttgtttatcgcggtgagttttgtttatttttaatt |
81 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19962661 |
atgaaggaagcttttgagtctgttggagctttgtttatcacggtgagttttgtttatttttaatt |
19962725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 134 - 229
Target Start/End: Complemental strand, 44983654 - 44983559
Alignment:
| Q |
134 |
tggaaattactctttgtgttatgtggaagtgcttttgaaggctgtgttagaatcaagatatatcacttttatcggttttggtcgtgttctgttata |
229 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||| |||||| ||||| ||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44983654 |
tggaaattactcagtgtgttctgtggaagtgcttatgaaggtagtgtttgaatcaaaatatatcacttttatcggcgttggtcgtgttctgttata |
44983559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 84 - 140
Target Start/End: Original strand, 47528410 - 47528466
Alignment:
| Q |
84 |
atttatgttaagttttctgtgctgttacatttgggctgtttgtatgattctggaaat |
140 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | |||||||||||||| |||| |
|
|
| T |
47528410 |
atttatgttaagttttccctgctgttacatttggtttctttgtatgattctgaaaat |
47528466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University