View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2211_low_21 (Length: 338)
Name: NF2211_low_21
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2211_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 17 - 176
Target Start/End: Original strand, 41308278 - 41308421
Alignment:
| Q |
17 |
gatgtttgattcgttatgtgaatcaacaatatttttagaaaacaacacaccgtactgtgcaaggcaagtagaattgggagcatcttaatgctaatggtca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41308278 |
gatgtttgattcgttatgtgaatcaacaatatttttagaaaacaacacaccgtactgtgcaaggcaagtagaattgggagcatc---------------- |
41308361 |
T |
|
| Q |
117 |
tttgctaatctgcttcacagaataacaggtctcataacttatatgaatatctaaaagaaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41308362 |
tttgctaatctgcttcacagaataacaggtctcataactcatatgaatatctaaaagaaa |
41308421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 244 - 338
Target Start/End: Original strand, 41308486 - 41308580
Alignment:
| Q |
244 |
aaaataagagatcttagtaatttaaattgtgatcaagaggtaagtaataatggtctaaaaattgttcttgccatgatttcgaaccggattctctc |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41308486 |
aaaataagagatcttagtaatttaaattgtgatcaagaggtaagtaataatggtctaaaaattgttcttgccatgatttcgaaccggattctctc |
41308580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University