View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2211_low_35 (Length: 266)

Name: NF2211_low_35
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2211_low_35
NF2211_low_35
[»] chr2 (1 HSPs)
chr2 (17-266)||(5047193-5047442)


Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 17 - 266
Target Start/End: Complemental strand, 5047442 - 5047193
Alignment:
17 aaaatctctggatgtggaagcaattggtagccaggtttatgatcttatatatccaatcaatttacttgagatcaatgcttgcagtgttataacaatatca 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5047442 aaaatctctggatgtggaagcaattggtagccaggtttatgatcttatatatccaatcaatttacttgagatcaatgcttgcagtgttataacaatatca 5047343  T
117 gtatttaaacaccttgcattttagattacagatgcagttcttgcaaaggaggccacagttgctgactatatcaaaattgtacttcctcttcttttgaaaa 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5047342 gtatttaaacaccttgcattttagattacagatgcagttcttgcaaaggaggccacagttgctgactatatcaaaattgtacttcctcttcttttgaaaa 5047243  T
217 atagagctgttcacttccttggatatgcaaatcgacttggttttgatcct 266  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||    
5047242 atagagttgttcacttccttggatatgcaaatcgacttggttttgatcct 5047193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University