View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2211_low_39 (Length: 251)
Name: NF2211_low_39
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2211_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 13 - 191
Target Start/End: Original strand, 36769522 - 36769700
Alignment:
| Q |
13 |
aatatgagttaaaaccaaaattgcaacaaatttgacaattgaatgattnnnnnnnttgaagaccggaatattcgattttaaaaagaggagactatttttg |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36769522 |
aatatgggttaaaaccaaaattgcaacaaatttgacaatcgaatgattaaaaaaattgaagaccggaatattcgattttaaaaagaggagactatttttg |
36769621 |
T |
 |
| Q |
113 |
taagtttaaaaaatataggatgaaaagtaaaattaagccaatattttaactattggccaaacttccactttttttatgt |
191 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
36769622 |
taagcttaaaaaatataggatgaaaagtaaaattaagccaatattttaactattgcccaaacttccactctttttatgt |
36769700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University