View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2211_low_43 (Length: 247)

Name: NF2211_low_43
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2211_low_43
NF2211_low_43
[»] chr3 (3 HSPs)
chr3 (95-229)||(47349557-47349691)
chr3 (1-87)||(47341642-47341728)
chr3 (96-223)||(47347019-47347146)
[»] chr1 (1 HSPs)
chr1 (96-165)||(5401451-5401520)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 95 - 229
Target Start/End: Original strand, 47349557 - 47349691
Alignment:
95 catcccaaatgctctgaatctgtgccacgtgtctcttcaaactggtgggaaacactatttaggacccttcgcgttgatcgacaagattaatagccacgag 194  Q
    |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47349557 catcccaaatgctccgaatctctgccacgtgtctcttcaaactggtgggaaacactatttaggacccttcgcgttgatcgacaagattaatagccacgag 47349656  T
195 ccgccctttacggaggatctaccgcgtttggatat 229  Q
    ||| |||||||||||||||||||||||||||||||    
47349657 ccgtcctttacggaggatctaccgcgtttggatat 47349691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 47341642 - 47341728
Alignment:
1 acagggtaacactcaataaaggaaggggcgattaaatgtggcaaaannnnnnntgattttatgactcgggactcgagttagctgtta 87  Q
    ||||||| |||||||||||||||||||||| |||||||||||||||       | ||||||||||||||||||||||||| ||||||    
47341642 acagggtgacactcaataaaggaaggggcggttaaatgtggcaaaaccccccctaattttatgactcgggactcgagttaactgtta 47341728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 96 - 223
Target Start/End: Original strand, 47347019 - 47347146
Alignment:
96 atcccaaatgctctgaatctgtgccacgtgtctcttcaaactggtgggaaacactatttaggacccttcgcgttgatcgacaagattaatagccacgagc 195  Q
    |||||||| || | ||||||  |||||||||| |||||||| ||||| ||||||||||||||||| || |   ||||||  ||||||||||| || ||||    
47347019 atcccaaacgcaccgaatctccgccacgtgtcacttcaaaccggtggaaaacactatttaggaccgtttgatctgatcgggaagattaatagtcatgagc 47347118  T
196 cgccctttacggaggatctaccgcgttt 223  Q
    |||| || ||||||||| ||||||||||    
47347119 cgccgttcacggaggatttaccgcgttt 47347146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 165
Target Start/End: Complemental strand, 5401520 - 5401451
Alignment:
96 atcccaaatgctctgaatctgtgccacgtgtctcttcaaactggtgggaaacactatttaggacccttcg 165  Q
    |||||||||||||  ||||| | ||| ||||||||||| |||||||  || |||||| ||||||||||||    
5401520 atcccaaatgctccaaatctttcccatgtgtctcttcagactggtgccaagcactatgtaggacccttcg 5401451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University