View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2211_low_44 (Length: 241)
Name: NF2211_low_44
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2211_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 35520237 - 35520421
Alignment:
| Q |
18 |
ctttcactatgaaccttactaacaatgaagtgtcc-tctctaattaggcgaccattttccaaatttaatattttttaattgatattcacaagatattcaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||| |
|
|
| T |
35520237 |
ctttcactatgaaccttactaacaatgaagtgtccctctctaattaggcgaccattttccaaatttaatattttttaattgcaattcaccagatgttcaa |
35520336 |
T |
 |
| Q |
117 |
taaaagacggaactaacatgcaacatagacatccttataaatagataaacaacattgtttgattatcttctaataaaaagttgat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35520337 |
taaaagacggaactaacatgcaacatagacatccttataatcagataaacaacattgtttgattatcttctaataaaaagttgat |
35520421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 192 - 231
Target Start/End: Original strand, 35523989 - 35524028
Alignment:
| Q |
192 |
aaaagttgatacggttgatttggcagaggtgatgatgatg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35523989 |
aaaagttgatacggttgatttggcagaggtgatgatgatg |
35524028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University