View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2211_low_46 (Length: 238)

Name: NF2211_low_46
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2211_low_46
NF2211_low_46
[»] chr7 (1 HSPs)
chr7 (17-81)||(1971679-1971743)
[»] chr8 (1 HSPs)
chr8 (17-81)||(19962661-19962725)
[»] chr4 (2 HSPs)
chr4 (134-229)||(44983559-44983654)
chr4 (84-140)||(47528410-47528466)


Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 17 - 81
Target Start/End: Original strand, 1971679 - 1971743
Alignment:
17 atgaaggaagcttttgggtctgttggagctttgtttatcgcggtgagttttgtttatttttaatt 81  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1971679 atgaaggaagcttttgggtctgttggagctttgtttatcgcggtgagttttgtttatttttaatt 1971743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 17 - 81
Target Start/End: Original strand, 19962661 - 19962725
Alignment:
17 atgaaggaagcttttgggtctgttggagctttgtttatcgcggtgagttttgtttatttttaatt 81  Q
    |||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||    
19962661 atgaaggaagcttttgagtctgttggagctttgtttatcacggtgagttttgtttatttttaatt 19962725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 134 - 229
Target Start/End: Complemental strand, 44983654 - 44983559
Alignment:
134 tggaaattactctttgtgttatgtggaagtgcttttgaaggctgtgttagaatcaagatatatcacttttatcggttttggtcgtgttctgttata 229  Q
    ||||||||||||  |||||| ||||||||||||| ||||||  ||||| ||||||| ||||||||||||||||||  |||||||||||||||||||    
44983654 tggaaattactcagtgtgttctgtggaagtgcttatgaaggtagtgtttgaatcaaaatatatcacttttatcggcgttggtcgtgttctgttata 44983559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 84 - 140
Target Start/End: Original strand, 47528410 - 47528466
Alignment:
84 atttatgttaagttttctgtgctgttacatttgggctgtttgtatgattctggaaat 140  Q
    |||||||||||||||||  |||||||||||||||  | |||||||||||||| ||||    
47528410 atttatgttaagttttccctgctgttacatttggtttctttgtatgattctgaaaat 47528466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University