View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2211_low_47 (Length: 238)
Name: NF2211_low_47
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2211_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 47238375 - 47238153
Alignment:
| Q |
1 |
aaggctagacctaccgttgattctagcgccgttgataaggattctgctgctgtggcacctaccgttgatgatcctccttctgcagaggatgctcctgaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47238375 |
aaggctagacctaccgttgattctagcgccgttgataaggattctgctgctgtggcacctaccgttgatgatcctccttctgcagaggatgctgctgaat |
47238276 |
T |
 |
| Q |
101 |
ccgcgaagatcgagacggagactgaaacctgatcattggggattatagtatgttgttgtgggattttatattttaatatcttgtttagtatgatgatcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47238275 |
ccgcgaagatcgagacggagactgaaacctgatcattggggattatagtatgttgttgtgggattttatattttaatatcttgtttagtatgatgatcta |
47238176 |
T |
 |
| Q |
201 |
tctgtagaactttgatgatttct |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
47238175 |
tctgtagaactttgatgatttct |
47238153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University