View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2211_low_54 (Length: 210)
Name: NF2211_low_54
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2211_low_54 |
 |  |
|
| [»] scaffold0091 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0091 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: scaffold0091
Description:
Target: scaffold0091; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 448 - 265
Alignment:
| Q |
15 |
gaaaatgtatggta---atttatacatgctacaacataattatggcatgaatcattacagctggtttgcattgaagataaacaaggcttattcttcactc |
111 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
448 |
gaaaatgtatggtattaatttatacatgctacagcataattatggcatgaatcattacagctggtttgcattgaagataaacaaggcttattcttcactc |
349 |
T |
 |
| Q |
112 |
ctctattctcatagcctttgcttgagaccaaagaagggaattgttggaacattcaaaaacaataggaagttttgtctactttct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
348 |
ctctattctcatagcctttgcttgagaccaaagaagggaattgttggaacattcaaaaacaataggaagttttgtctactttct |
265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University