View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2211_low_56 (Length: 204)
Name: NF2211_low_56
Description: NF2211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2211_low_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 15 - 181
Target Start/End: Original strand, 26568300 - 26568466
Alignment:
| Q |
15 |
atgaactacactaagctcaccataaagcactctatgagataaacttgtggtcccaactcaataatatgcatgctttgatttcacatgtcttgtgcaaacg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26568300 |
atgaactacactaagctcaccataaagcactctatgagataaacttgtggtcctagctcaataatatgcatgctttgatttcacatgtcttgtacaaacg |
26568399 |
T |
|
| Q |
115 |
atcaacgtctttgaaagcacgtcttaacttcacatgttctgtatgcacgaattgcagcctagatcac |
181 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
26568400 |
atcaacgtctttgaaagcgcgtcttaacttcacatgttctgtatggacgagttgcagcctagatcac |
26568466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 54 - 181
Target Start/End: Original strand, 24556875 - 24557002
Alignment:
| Q |
54 |
taaacttgtggtcccaactcaataatatgcatgctttgatttcacatgtcttgtgcaaacgatcaacgtctttgaaagcacgtcttaacttcacatgttc |
153 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||| ||||| |||||||||| |||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
24556875 |
taaacttgtggtcccagctcaagaatatgcatgctctgattctacatgtcttgcacaaacgatcaacgtctttaaaagcacgtcttaacttcacgcgttc |
24556974 |
T |
|
| Q |
154 |
tgtatgcacgaattgcagcctagatcac |
181 |
Q |
| |
|
||| | |||| ||||||| |||||||| |
|
|
| T |
24556975 |
cgtacggacgagttgcagcttagatcac |
24557002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 51 - 180
Target Start/End: Original strand, 7644346 - 7644476
Alignment:
| Q |
51 |
agataaacttgtggtcccaactcaataatatgcatgctttgatttcacatgtcttgtgcaaacgatcaacgtctttg-aaagcacgtcttaacttcacat |
149 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| ||||||| |||||||||| |||||||||| ||||||| ||||| |||||||||| ||| |
|
|
| T |
7644346 |
agataaacttatggtcccaactcaagaatatgcatgctctgatttcgcatgtcttgtacaaacgatcactgtctttgaaaagcgtgtcttaactttacac |
7644445 |
T |
|
| Q |
150 |
gttctgtatgcacgaattgcagcctagatca |
180 |
Q |
| |
|
||||| || | || ||||||||||||||| |
|
|
| T |
7644446 |
gttctatactgatgagttgcagcctagatca |
7644476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University