View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2212_high_7 (Length: 276)
Name: NF2212_high_7
Description: NF2212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2212_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 3305248 - 3304980
Alignment:
| Q |
1 |
aacaaatggacatagctctcttctctacatcatctctcttcgccgaagaagatgatgacgatgacattcataccaagggtactannnnnnnnnnnn---- |
96 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3305248 |
aacaaatggacatagctctcttctccacatcatctctcttcgccgaagaagatgatgacgatgacattcataccaagggtactactctctctctctctct |
3305149 |
T |
|
| Q |
97 |
------gcttgtttcttctttgattcctatgttgacaaattatgtttctgaatgcagatgaggaaaacgctgagactcatgaaacctatgttgagaggaa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3305148 |
ctctctgcttgtttcttctttgattcctatgttgacaaattatgtttctgaatgcagatgaggaaaacgctgagactcatgaaacttatgttgagaggaa |
3305049 |
T |
|
| Q |
191 |
gcatcagttccctggaatggtaaactaaagttttcttttttaatattcattcatcatatcgccattatt |
259 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3305048 |
gcatcagttccctggaatggtaaagtaaagttttcatttttaatattcattcatcatatcgccattatt |
3304980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University