View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2212_high_9 (Length: 249)
Name: NF2212_high_9
Description: NF2212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2212_high_9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 8 - 249
Target Start/End: Complemental strand, 17262598 - 17262362
Alignment:
| Q |
8 |
agagaagaaggataggacattagtttttcctccatgctctaactgatttttctgcattgtgatggtttgattttctttacctattgtcttgatgaccaat |
107 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
17262598 |
agagaagaagggtaggacattagtttttcctccatgctctaactgatttttctgcattgtgatggtttga----gtttacctattgtcttgatgaccgat |
17262503 |
T |
 |
| Q |
108 |
acaatcacgccttttttgatggatgaaatgtatattagtagnnnnnnnnnnnnnnnnnnnnnnnnctattgacttcacaattcagataatagagtgacaa |
207 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
17262502 |
aaaatcacgcc-tttttgatggatgaaatgtatattagtagttttaactttttttctttctttttctattgacttcacacttcagataatagagtgacaa |
17262404 |
T |
 |
| Q |
208 |
atgacgatgcgatgctgaaaatctcacgatgaaagttgattt |
249 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17262403 |
atgaagatgcgatgctgaaaatctcacgatgaaagttgattt |
17262362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University