View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2212_low_11 (Length: 276)
Name: NF2212_low_11
Description: NF2212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2212_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 16277619 - 16277369
Alignment:
| Q |
18 |
gtgccttattatacaacaatcaagtaggttcttgtgatttctcttcattattttgaacaaaatcttccgtcctagtaaagagacaatattattttaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16277619 |
gtgccttattatacaacaatcaagtaggttcttgtgatttctcttcattattttgaacaaaatcttccgtcctagtaaagagacaatattattttaattt |
16277520 |
T |
 |
| Q |
118 |
gaatgaaatgaaatgagcggactattcatctaaagtggtctatttgcaataaggtcacaaagctgtgacattataaagatgcttacgtgtgtatttccct |
217 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16277519 |
gaatgaaatgaaatgagaggactattcatctaaagtggtctatttgcaataaggtcacaaagctgtgacattataaagatgcttacgcgtgtatttccct |
16277420 |
T |
 |
| Q |
218 |
catcgaaaaactatgaatttctcatcaggtatgttttctttcatctctctc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16277419 |
catcgaaaaactatgaatttctcatcaggtatgttttctttcatatctctc |
16277369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University