View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2212_low_17 (Length: 229)
Name: NF2212_low_17
Description: NF2212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2212_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 17109899 - 17110085
Alignment:
| Q |
1 |
ctcaaacaacgtgaccacaagggtcgcgaccacctcctctcactttcagcaataactcttaaaaactgtcccaacataaaacgtttaccgaaggagggtc |
100 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||||||| ||| |||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17109899 |
ctcaaacaacttgactacaagggtctcgaccacctcccctctctttcatcattaactcttaaaaactgtcccaacataaaacgtttaccgaaggagggtc |
17109998 |
T |
 |
| Q |
101 |
tacctagatccatatcaactttacagattttggggaactgtccattccttttagaaagatgcaagaaaccttatggaaaggattgcg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17109999 |
tacctagatccatatcaactttacagatttcggggaactgtccattccttttagaaagatgcaagaaaccttatggaaaggattgcg |
17110085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 212
Target Start/End: Original strand, 17110088 - 17110121
Alignment:
| Q |
179 |
aggattgcgcatattcaatgtataatgattgacg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
17110088 |
aggattgcgcatattcaatgtataatgattgacg |
17110121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University