View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2212_low_7 (Length: 296)
Name: NF2212_low_7
Description: NF2212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2212_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 54 - 279
Target Start/End: Original strand, 10589764 - 10589989
Alignment:
| Q |
54 |
atctatgtgatgtatggatgtacctagatcattttccatatatttgtgcaaggctacaaataaataagagaagtgatggtgtctagaagggaaatgaacc |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10589764 |
atctatgtgatgtatggatgtacctagatcattttccatatatttgtgcaaggctacaaataaataagagaagtgatggtgtctagaagggaaacgaacc |
10589863 |
T |
 |
| Q |
154 |
gtgataaatgatagagctcttttttaacatattgttttctatttatttctcactttctatcgcattatcaacttatcactatatatcaaaaataaaaatc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10589864 |
gtgataaatgatagagctcttttttaacatattgttttctatttatttctcactttctatcgcattatcaacttatcactatatatcaaaaataaaaatc |
10589963 |
T |
 |
| Q |
254 |
aacctatcacaccattagttttattc |
279 |
Q |
| |
|
|||||||||||| | ||||||||||| |
|
|
| T |
10589964 |
aacctatcacactactagttttattc |
10589989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University