View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2213_high_2 (Length: 249)
Name: NF2213_high_2
Description: NF2213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2213_high_2 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 38 - 249
Target Start/End: Complemental strand, 36304882 - 36304666
Alignment:
| Q |
38 |
taacaatttgtcttagaaactaccattatttattgcgnnnnnnnn-----ccaattcttatttttcggctaatccactgtggtaattagggctttgacat |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36304882 |
taacaatttgtcttagaaactaccattatttattgcggaaaaaaaaaaaaccaattcttatttttcggctaatccactgtggtaattagggctttgacat |
36304783 |
T |
|
| Q |
133 |
cagtaggtgcctcaaggtatcctcagtttaagtcttttgagcccactaagagtaatcatcaaatcgacagaggaatgcccactttttacaccggtgccaa |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
36304782 |
cagtaggtgcctcaaggtatcctcagtttaagtcttttgcgcccactaagagtaatcgtcaaatcgacagaggaacgcccactttttataccggtgccaa |
36304683 |
T |
|
| Q |
233 |
ccaaatgggcgactcta |
249 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
36304682 |
ccaaatgggcaactcta |
36304666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University