View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2213_low_2 (Length: 250)
Name: NF2213_low_2
Description: NF2213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2213_low_2 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 39522548 - 39522314
Alignment:
| Q |
16 |
ataatttacagaacttatccaaaattgttgggtaagcaatttctaattctttgatgctaataactgttttgagaatttgttattagacttttaagtaata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39522548 |
ataatttacagaacttatccaaaattgttgggtaagcaatttctaattctttgatgctaataactgttttgagaatttgttattagaattttaagtaata |
39522449 |
T |
 |
| Q |
116 |
tgtaacaaaattaagctaagctatataccccacaccactttctcaactcttctgtgataaatttgcagcaaatactttatagtggtaattttcacnnnnn |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39522448 |
tgtaacaaaattaagctaagctatataccccacaccactttctcaactcttctgtgataaatttgcagcaaatactttatagtggtaattttcacttttt |
39522349 |
T |
 |
| Q |
216 |
nnggtcttattgtcttaaccagtaaatttgttact |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39522348 |
ttggtcttattgtcttaaccagtaaatttgttact |
39522314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University