View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2214_low_3 (Length: 336)
Name: NF2214_low_3
Description: NF2214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2214_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 113 - 321
Target Start/End: Complemental strand, 36819499 - 36819292
Alignment:
| Q |
113 |
ttgatttgaattcatcacgatcttctttttcttcagtttaagttcgacttgattccaatttttattattaatgtttgggagaatttttaagtacgagatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36819499 |
ttgatttgaattcatcacgatcttctttttcttcagtttaagttcgacttgattccaatttttattattaatgtttgggaaaatttttaagtacgagatt |
36819400 |
T |
 |
| Q |
213 |
tttaatgttgaatataactaaattatcaattttaaacaataacatgacacgtaaaaaacnnnnnnnnngagaggtcgcttaaaataactttgtttacctt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36819399 |
tttaatgttgaatataactaaattatcaattttaaacaataacatgacatgtaaaaaac-ttttttttgagaggtcgcttaaaataactttgtttacctt |
36819301 |
T |
 |
| Q |
313 |
catgttatt |
321 |
Q |
| |
|
||||||||| |
|
|
| T |
36819300 |
catgttatt |
36819292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University