View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2214_low_5 (Length: 246)
Name: NF2214_low_5
Description: NF2214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2214_low_5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 10 - 246
Target Start/End: Original strand, 38958769 - 38959005
Alignment:
| Q |
10 |
agaacctgtgagtagataagaactctcgtttggttatttgatgacccttttcggttatgtaattcaagtgagttttgtggattaattctcaagccgtgag |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38958769 |
agaaccagtgagtagataagaactctcgtttggttatttgatgacccttttcggttatgtaattcaagtgagttttgtggattaattctcaagccgtgag |
38958868 |
T |
|
| Q |
110 |
tggtaaactcctgcggcatgcttcttaacattggtacagtctcaagccaataacttttgccttgttgcccaatgtttacagattgaagttaacgaataga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38958869 |
tggtaaactcctgcggcatgcttcttaacattagtacagtctcaggccaataacttttgccttgttgcccaatgtttacagattgaagttaacgaataga |
38958968 |
T |
|
| Q |
210 |
tacgcaacaatttgagatgatatattttgtttgtatt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38958969 |
tacgcaacaatttgagatgatatattttgtttgtatt |
38959005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University